View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6619_low_39 (Length: 229)
Name: NF6619_low_39
Description: NF6619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6619_low_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 50 - 153
Target Start/End: Complemental strand, 51433688 - 51433585
Alignment:
| Q |
50 |
ctgctaactggtaattctctcataactcatatcatatatgtatttttgattttaatcctatactttagtaatctagagttaggctaaaagttaagtaaaa |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
51433688 |
ctgctaactggtaattctctcataactcatatcatatatgtatttttggttttaatcctatactttagtaatctagagttcggcttaaagttaagtaaaa |
51433589 |
T |
 |
| Q |
150 |
ttat |
153 |
Q |
| |
|
|||| |
|
|
| T |
51433588 |
ttat |
51433585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 206
Target Start/End: Complemental strand, 51433587 - 51433557
Alignment:
| Q |
176 |
tatgtgtcttgctaaatatttctatttatac |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
51433587 |
tatgtgtcttgctaaatatttctatttatac |
51433557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University