View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6620_high_3 (Length: 276)
Name: NF6620_high_3
Description: NF6620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6620_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 19 - 261
Target Start/End: Original strand, 36605394 - 36605636
Alignment:
| Q |
19 |
ggcagaccagtcaagcccaattgcgccgatgccgagaccctttaggcccgacccaagctgctgggccaatacactatgaggaaatacccaacatatccaa |
118 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36605394 |
ggcagaccagtcaagcccaattgcaccgatgccgagaccctttaggcccgacccaagctgctgggccaatacactatgaggaaatacccaacatatccaa |
36605493 |
T |
 |
| Q |
119 |
gagagtgaggttaacatttgaaaaaggtaaccagggaaaacgtagtatgcaaagctgcacaaaaatgatataacgaagaattgagaacgtgttaagcctc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36605494 |
gagagtgaggttaacatttgaaaaaggtaaccagggaaaacgtagtatgcaaagctgcacaaaaatgatataacgaagaattgagaacgtgttaagcctc |
36605593 |
T |
 |
| Q |
219 |
cttttgttctttcctccttctcatgcaaagccctaagtcacag |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36605594 |
cttttgttctttcctccttctcatgcaaagccctaagtcacag |
36605636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 98 - 222
Target Start/End: Original strand, 21172932 - 21173056
Alignment:
| Q |
98 |
ggaaatacccaacatatccaagagagtgaggttaacatttgaaaaaggtaaccagggaaaacgtagtatgcaaagctgcacaaaaatgatataacgaaga |
197 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||| |||| | |||||| || || || || |||||||| ||||| | ||||| ||||| ||||| |
|
|
| T |
21172932 |
ggaaacacccaacatatccaagagagtgatgttaacattggaaataagtaacctggcaatacataatatgcaaaactgcaaataaatgttataaggaaga |
21173031 |
T |
 |
| Q |
198 |
attgagaacgtgttaagcctccttt |
222 |
Q |
| |
|
| ||| ||||||||||||||||| |
|
|
| T |
21173032 |
actgatttcgtgttaagcctccttt |
21173056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University