View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6620_low_6 (Length: 228)
Name: NF6620_low_6
Description: NF6620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6620_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 9e-54; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 5 - 119
Target Start/End: Complemental strand, 41640217 - 41640103
Alignment:
| Q |
5 |
cagcagacatggctgatacacggcacgtgggctctagaaatcgaataccaaatagtatattctatattattctctttgaggattgctaggaactaggcag |
104 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41640217 |
cagcagacatgcctgatacacggcacgtgggctctagaaatcgaataccaaatagtatattctatattattctctttgaggattgctagtaactaggcag |
41640118 |
T |
|
| Q |
105 |
gcaatcccaatattt |
119 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
41640117 |
gcaatcccaatattt |
41640103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 162 - 228
Target Start/End: Complemental strand, 41639684 - 41639618
Alignment:
| Q |
162 |
tatagataaagactaaattgactttggtttgctgattttgttgttagaatagttcctaccattgaat |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |||||| |
|
|
| T |
41639684 |
tatagataaagactaaattgactttggtttgctaattttgttattagaatagttcctaccgttgaat |
41639618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 121 - 170
Target Start/End: Complemental strand, 41639909 - 41639860
Alignment:
| Q |
121 |
tcacaaatgcaaattataagaattggggattttttacaccatatagataa |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41639909 |
tcacaaatgcaaattataagaattggggattttttacaccatatagataa |
41639860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University