View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6621_low_8 (Length: 251)
Name: NF6621_low_8
Description: NF6621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6621_low_8 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 155 - 251
Target Start/End: Original strand, 46355616 - 46355712
Alignment:
| Q |
155 |
ttatacatggtgttacatggttattatatgactcacttttgcggttacccaacgtatatgttttgaaaccggatctccaaaaacatccttcgaagaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
46355616 |
ttatacatggtgttacatggttattatatgactcacttttgcggttacccaacgtatatgttttgaaaccggatctccaaaaacatcctttgaagaa |
46355712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 41
Target Start/End: Original strand, 46355473 - 46355501
Alignment:
| Q |
13 |
aatataaatagttggaaccacacccaatc |
41 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
46355473 |
aatataaatagttggaaccacacccaatc |
46355501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University