View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6621_low_9 (Length: 232)
Name: NF6621_low_9
Description: NF6621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6621_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 2 - 222
Target Start/End: Original strand, 9424266 - 9424486
Alignment:
| Q |
2 |
tgaacgagcagaacctgtgtatggtgacaaagtttccatcatctacaatgatcatgttagattttcttggagagaaacctatgaaagatgtctcaagctt |
101 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9424266 |
tgaacgagcagccactgtgtatggtgacaaagtttccatcatctacaatgatcatgttagattttcttggagagaaacctatgaaagatgtctcaagctt |
9424365 |
T |
 |
| Q |
102 |
gcttctgctttggtcaacttaggaatttctaatggtgatattgtaagttcatttatctcccaatctccttatggttatattatactttcctctcaagcta |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9424366 |
gcttctgctttggtcaacttaggaatttctaatggtgatattgtaagttcatttatctcccaatctccttatggttatattatactttcctctcaagcta |
9424465 |
T |
 |
| Q |
202 |
actattgtttttcttctctct |
222 |
Q |
| |
|
|||||||||||| |||||||| |
|
|
| T |
9424466 |
actattgtttttgttctctct |
9424486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University