View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6622_high_20 (Length: 285)
Name: NF6622_high_20
Description: NF6622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6622_high_20 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 285
Target Start/End: Complemental strand, 30878361 - 30878070
Alignment:
| Q |
1 |
cgactcacttatattttttcatatactagtaaaatataata-------tagagaagtttaaggataatttaaatgattttagtatggatatgatcctctc |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30878361 |
cgactcacttatattttttcatatactagtaaaatataatacgtttaatagagaagtttaaggataatttaaatgattttagtatggatatgatcctctc |
30878262 |
T |
 |
| Q |
94 |
acatggatttatagtggattgtgtgacgattttattgaactaaacttaaaaattattattaatatttgattctatatgattgtagtatgcataaactatt |
193 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30878261 |
acctggatttatagtggattgtgtgacgattttattgaactaaaattaaaaattattattaatatttgattctatatgattctagtatgcataaactatt |
30878162 |
T |
 |
| Q |
194 |
gaaatcaagcaaatttttcaacattttacatgtaaagaaagtaccaatgccacaccttacatcttattggtacaagaacttctccaatataa |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30878161 |
gaaatcaagcaaatttttcaacattttacaagtaaagaaagtaccaaggccacaccttacatcttattggtacaagaacttctccaatataa |
30878070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University