View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6622_high_27 (Length: 244)
Name: NF6622_high_27
Description: NF6622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6622_high_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 3809476 - 3809702
Alignment:
| Q |
1 |
tcatttgttgttgagcttgagcgacggacatggaaaactacacagtccaggggtaatatcacgagtagctttactatacgatgttcatagaagtatcatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3809476 |
tcatttgttgttgagcttgagcgacggacatggaaaactacacagtccaggggtaatatcccgagcagctttactatacgatgttcatagaagtatcatt |
3809575 |
T |
|
| Q |
101 |
tttcgtatatggaaacaagtaatggagactggtaatgcttatcataagaaaacacgctgtggaaggaaacgtgttcagttagatttggagttaatgcgtc |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3809576 |
tatcgtatatggaaacaagtaatggagactggtaatgcttatcataagaaaaaacgatgtggaaggaaatgtgttcagttagatttggagttaatgcgtc |
3809675 |
T |
|
| Q |
201 |
aagttccattgtcaaaacgatctacct |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
3809676 |
aagttccattgtcaaaacgatctacct |
3809702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 11 - 46
Target Start/End: Original strand, 3809421 - 3809456
Alignment:
| Q |
11 |
ttgagcttgagcgacggacatggaaaactacacagt |
46 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3809421 |
ttgagcttgagcgatggacatggaaaactacacagt |
3809456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University