View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6622_low_28 (Length: 253)
Name: NF6622_low_28
Description: NF6622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6622_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 42237296 - 42237398
Alignment:
| Q |
1 |
atcagacggttcatgaagagattatgtggtgttattggtggtatcttagaccacgttgcttcactgcacaaagattcttgttcccattaaacaaactagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42237296 |
atcagacggttcatgaagagattatgtggtgtcattggtggtatcttagaccacgttgcttcactgcacaaagattcttgttcccattaaacaaactagg |
42237395 |
T |
 |
| Q |
101 |
aaa |
103 |
Q |
| |
|
||| |
|
|
| T |
42237396 |
aaa |
42237398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 173 - 236
Target Start/End: Original strand, 42237468 - 42237531
Alignment:
| Q |
173 |
gggtatacagtacaatcatgcagaccagtgtgtgaaagggtaccacctcatgattgtcatggat |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42237468 |
gggtatacagtacaatcatgcagaccagtgtgtgaaagggtaccacctcatgattgtcatggat |
42237531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University