View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6622_low_29 (Length: 251)
Name: NF6622_low_29
Description: NF6622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6622_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 22 - 241
Target Start/End: Complemental strand, 24264040 - 24263821
Alignment:
| Q |
22 |
aaaacttaagaaaattatattagcaaatctaaaaaatactaaaaacgttgagcaatgacaaatcatgatttgtgtctggtatgtaatttggaagctaaaa |
121 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24264040 |
aaaacttaagaaaattatattaccaaatctaaaaaatactaaaaacgttgagcaatgacaaatcatgatttgtgtctggtatgtaatttggaagctaaaa |
24263941 |
T |
 |
| Q |
122 |
ctgtgatacacgcgtttagggacggaacatgttttgaagttttggagagctcgcaagattaccgataatgatccagttttcttcggcgacacgcgctgta |
221 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24263940 |
ctgtgatacacgcgtttaggaacggaacatgttttgaagttttggagagctcgcaagattactgataatgatccagttttcttcggcgacacgcgctgta |
24263841 |
T |
 |
| Q |
222 |
cctttagaagtaatcctttg |
241 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
24263840 |
cctttagaagtaatcctttg |
24263821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University