View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6622_low_31 (Length: 248)
Name: NF6622_low_31
Description: NF6622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6622_low_31 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 19 - 248
Target Start/End: Original strand, 3027740 - 3027969
Alignment:
| Q |
19 |
gcaattggaaattttgaatgtgcgtattattgaggtggttcatcgaatatacaacttccatctcaagttgtcctgaggcaatctgatcaagacagaaaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3027740 |
gcaattggaaattttgaatgtgcgtattattgaggtggttcatcgaatatacaacttccatctcaagttgtcctgaggcaatctgatcaagacagaaaat |
3027839 |
T |
 |
| Q |
119 |
cctgaaagatgaattgataatgactgagaaaagacgaaagtaattggaccaaaatggttaatcagctctagttaaggatgaattgctcggaagaactttg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3027840 |
cctgaaagatgaattgataatgactgagaaaagacgaaagtaattggaccaaaatggttaatcagctctagttaaggatgaattgctcggaagaactttg |
3027939 |
T |
 |
| Q |
219 |
aaccgagactagaacaatcattagtctgac |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3027940 |
aaccgagactagaacaatcattagtctgac |
3027969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University