View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6623_high_10 (Length: 436)
Name: NF6623_high_10
Description: NF6623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6623_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 3e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 34 - 205
Target Start/End: Complemental strand, 22657301 - 22657115
Alignment:
| Q |
34 |
tcaatttcggacaattgaattaattaaccaccataatctcagaaaaattaaattcaa--------------caaaatcaaaatttta-cattactacaac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
22657301 |
tcaatttcggacaattgaattaattaaccaccataatctcagaaaaattaaattcaagcaagaataaacttcaaaatcaaaattttaacattactacaac |
22657202 |
T |
 |
| Q |
119 |
aacaagcattactcatacatatacaattatacaaatcagtatctctgcaaatgtctctaaacagtaaataactattaccatcaatga |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| ||||||||||||||||||||||| |
|
|
| T |
22657201 |
aacaagcattactcatacatatacaattatacaaatcagtatctctgcaaatatctctatacaataaataactattaccatcaatga |
22657115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 111; E-Value: 7e-56
Query Start/End: Original strand, 300 - 418
Target Start/End: Complemental strand, 22657014 - 22656896
Alignment:
| Q |
300 |
caccccttgcagagacttcatagaaaacatggatcagttattatgatcggaattatatccacccggtgtaggtggtgttgatgaaggggaatgatctccg |
399 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22657014 |
caccccttgcagagacttaataggaaacatggatcagttattatgatcggaattatatccacccggtgtaggtggtgttgatgaaggggaatgatctccg |
22656915 |
T |
 |
| Q |
400 |
tcttcagttccgtcaccgt |
418 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
22656914 |
tcttcagttccgtcaccgt |
22656896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University