View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6623_high_17 (Length: 285)
Name: NF6623_high_17
Description: NF6623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6623_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 21 - 269
Target Start/End: Complemental strand, 9454874 - 9454626
Alignment:
| Q |
21 |
tcacggttgcgagaattagtagcgggagttaccaaataaatgctaaaaatgagttcgacaataaatttaagactaagtggtcgtttgttttggcgcccaa |
120 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9454874 |
tcacggttgcgagaattagtagcggtagttaccaaatatatgctaaaaatgagttcgacaataaatttaagactaagtggtcgtttgttttggcgcccaa |
9454775 |
T |
 |
| Q |
121 |
aaagtgaacttgcgtttattttgaatctacagtttttagcttatgtatttttacgggtgcaatgctcttgaatgcatggtggcagtgaggaaaatgtgaa |
220 |
Q |
| |
|
||||||||| |||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| ||||||||||| ||| |
|
|
| T |
9454774 |
aaagtgaacgtgcgtttactttgaacctacagtttttagcttatgtatttttacgggtgcaatgctctcgcatgcatggtggcaatgaggaaaatgcgaa |
9454675 |
T |
 |
| Q |
221 |
tacaaatgcacgctaaatatcaattgtagagacaaaaaatacaaattct |
269 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9454674 |
tacaaacggacgctaaatatcaattgtagagacaaaaaatacaaattct |
9454626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University