View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6623_low_17 (Length: 285)

Name: NF6623_low_17
Description: NF6623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6623_low_17
NF6623_low_17
[»] chr2 (1 HSPs)
chr2 (21-269)||(9454626-9454874)


Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 21 - 269
Target Start/End: Complemental strand, 9454874 - 9454626
Alignment:
21 tcacggttgcgagaattagtagcgggagttaccaaataaatgctaaaaatgagttcgacaataaatttaagactaagtggtcgtttgttttggcgcccaa 120  Q
    ||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9454874 tcacggttgcgagaattagtagcggtagttaccaaatatatgctaaaaatgagttcgacaataaatttaagactaagtggtcgtttgttttggcgcccaa 9454775  T
121 aaagtgaacttgcgtttattttgaatctacagtttttagcttatgtatttttacgggtgcaatgctcttgaatgcatggtggcagtgaggaaaatgtgaa 220  Q
    ||||||||| |||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| ||||||||||| |||    
9454774 aaagtgaacgtgcgtttactttgaacctacagtttttagcttatgtatttttacgggtgcaatgctctcgcatgcatggtggcaatgaggaaaatgcgaa 9454675  T
221 tacaaatgcacgctaaatatcaattgtagagacaaaaaatacaaattct 269  Q
    |||||| | ||||||||||||||||||||||||||||||||||||||||    
9454674 tacaaacggacgctaaatatcaattgtagagacaaaaaatacaaattct 9454626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University