View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6623_low_26 (Length: 221)
Name: NF6623_low_26
Description: NF6623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6623_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 17 - 204
Target Start/End: Complemental strand, 18243105 - 18242918
Alignment:
| Q |
17 |
gtgtaaaaagctcgagtacagacaaagttcatgtgggactaatgcatgacaattagttgttaataatcgcgacattagtcttccagttaacaagaagaat |
116 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
18243105 |
gtgtaaaaagctcgagtacaaacaaagttcatgtgggactaatgcatgacaattacttgttaataatcgcgacattagtattccagttagcaagaagaat |
18243006 |
T |
|
| Q |
117 |
ctatagccaccagttgcatttgcatgattcttggattatcacattagttagatatttttgaacctgaaatcgacatttcgagaaaaag |
204 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18243005 |
ccatagccaccagttgcatttgcatgattcttggattatcacattagttagatatttttgaacctgaaatcgacatttcgagaaaaag |
18242918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University