View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6623_low_7 (Length: 477)
Name: NF6623_low_7
Description: NF6623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6623_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-121; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 19 - 243
Target Start/End: Complemental strand, 16586552 - 16586328
Alignment:
| Q |
19 |
gcctgacgtatgattatgtgacggatgatgcgacggatctgctgggtgagaaggatttggatgcgatctctggtttgtatggcttgttgatttcgagacc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16586552 |
gcctgacgtatgattatgtgacggatgatgcgacggatctgctgggtgagaaggatttggatgcgatctctggtttgtatggcttgttgatttcgagacc |
16586453 |
T |
 |
| Q |
119 |
ggccgattcgagcttttcgcataagaatgcgttgaggagatgtattgagcatgctaagttgtgggtttctaaggctcaacagcctattgatcccaatgtt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16586452 |
ggccgattcgagcttttcgcataagaatgcgttgaggagatgtatcgagcatgctaagttgtgggtttctaaggctcaacagcctattgatcccaatgtt |
16586353 |
T |
 |
| Q |
219 |
gatgttacatgtagggttttctgac |
243 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
16586352 |
gatgttacatgtagggttttctgac |
16586328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 22 - 117
Target Start/End: Original strand, 16588539 - 16588634
Alignment:
| Q |
22 |
tgacgtatgattatgtgacggatgatgcgacggatctgctgggtgagaaggatttggatgcgatctctggtttgtatggcttgttgatttcgagac |
117 |
Q |
| |
|
|||| ||||||||||||| |||||||||| ||||||| || ||||||| |||||| ||| ||| || ||||||||| | |||||||||||||||| |
|
|
| T |
16588539 |
tgacttatgattatgtgattgatgatgcgaaggatctgttgtgtgagaatgatttgtatgtgatatcgggtttgtataggttgttgatttcgagac |
16588634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University