View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6625_high_28 (Length: 377)
Name: NF6625_high_28
Description: NF6625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6625_high_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 6e-87; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 163 - 329
Target Start/End: Original strand, 31613424 - 31613590
Alignment:
| Q |
163 |
cttgccagagacactaaaccaaccactctatgatacattaactggaatggaggcagggcaaaaggtcacttctgcaacatctagtgtatgaacatgcttg |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31613424 |
cttgccagagacactaaaccaaccactctatgatacattaactggaatggaggcagggcaaaaggtcacttctgcaacatctagtgtatgaacatgcttg |
31613523 |
T |
 |
| Q |
263 |
caaactaatgtctcctttctttacttactgctgctggtttggtttatttgtttagatttcaattttg |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31613524 |
caaactaatgtctcctttctttacttactgctgctggtttggtttaattgtttagatttcaattttg |
31613590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 31613262 - 31613372
Alignment:
| Q |
1 |
ggagttgttcccaacggttgttaggaatgctgcacttgggtgtgctacacaagcagcacaaatgggtgcaatattggccccagttgttgtcgttttgggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| |
|
|
| T |
31613262 |
ggagttgttcccaacggttgttaggaatgctgcacttgggtgtgctacacaagcagcacaaatgggtgcaatattggcaccagttgttgtcgttttaggt |
31613361 |
T |
 |
| Q |
101 |
ggatcattgcc |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
31613362 |
ggatcattgcc |
31613372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University