View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6625_high_42 (Length: 270)
Name: NF6625_high_42
Description: NF6625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6625_high_42 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 17 - 270
Target Start/End: Complemental strand, 1506077 - 1505827
Alignment:
| Q |
17 |
cacttgacacattcaaatggtcggaattcattcatgattcatcatagccataggcacacttatcaaggtaaaagacaaaaggctaacaaagatttgttca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1506077 |
cacttgacacattcaaatggtcggaattcattcatgattcatcatagccataggcacacttatcaaggtaaaagacaaaaggctaacaaagatttgttca |
1505978 |
T |
|
| Q |
117 |
attgattccctcnnnnnnnnnnnncaagaagatttgttcaattgatgaattgaatatggatctcttttggacttaggtcaagcccgatgaaccatgaaaa |
216 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1505977 |
attgattccctcaaaaaaaaa---caagaagatttgttcaattgatgaattgaatatggatctcttttggacttaggtcaagcccgatgaaccatgaaaa |
1505881 |
T |
|
| Q |
217 |
cgggtatcattattgatctactacggaacatgatatggataaaattgcttgctc |
270 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
1505880 |
cgggtatcattattgatctactacggatcatgatatggagaaaattgcttgctc |
1505827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University