View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6625_high_43 (Length: 264)
Name: NF6625_high_43
Description: NF6625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6625_high_43 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 102; Significance: 1e-50; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 81 - 243
Target Start/End: Original strand, 11331641 - 11331790
Alignment:
| Q |
81 |
agatgtaccagttttggtaggcaaatcattgaatttgttttgagttataatggtgtaaaaatgggccttactaaactttaggaatgagagtgtgtataac |
180 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11331641 |
agatgtaccacttttggtaggcaaatcattgaatttgtt--gagttttaatg-----------ggccttactaaactttaggaatgagagtgtgtataac |
11331727 |
T |
|
| Q |
181 |
ttcttattatggaggagtactttaggaacaagttatattggtgatgagatttttacaaacaaa |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11331728 |
ttcttattatggaggagtactttaggaacaagttatactggtgatgagatttttacaaacaaa |
11331790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 11331426 - 11331512
Alignment:
| Q |
1 |
ttcataatcataatcatcatgtacatat----catagtttatcttctgataatttaacataaaatgttgcaggctatgatagccaga |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11331426 |
ttcataatcataatcatcatgtacatatatatcatagtttatcttctgataattttacataaaatgttgcaggctatgatagccaga |
11331512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 28 - 83
Target Start/End: Complemental strand, 7177008 - 7176953
Alignment:
| Q |
28 |
tcatagtttatcttctgataatttaacataaaatgttgcaggctatgatagccaga |
83 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
7177008 |
tcatagtttatcttctgacaatttaacacaaaatactgcaggctatgatagccaga |
7176953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University