View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6625_high_49 (Length: 244)
Name: NF6625_high_49
Description: NF6625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6625_high_49 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 12 - 228
Target Start/End: Complemental strand, 25825591 - 25825375
Alignment:
| Q |
12 |
agcaaagggaagattgagagtttgcatcataagagagttggttcaacattgtcttttagagagccaccaacttttcaaatgagtgaaaatgagagctttt |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25825591 |
agcaatgggaagattgagagtttgcatcataagagagttggttcaacattgtcttttagagagccaccaacttttcaaatgagtgaaaatgagagctttt |
25825492 |
T |
 |
| Q |
112 |
ttgtgcttagttttggaaatgaaggtgagagtggtaaagggttgaaatcaagtgggagaaaaaagaaaatgagttgttcagaattgaaggagaagaagaa |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25825491 |
ttgtgcttagttttggaaatgaaggtgagagtggtaaagggttgaaatcaaatgggagaaaaaagaaaatgagttgttcagaattgaaggagaagaagaa |
25825392 |
T |
 |
| Q |
212 |
caagggagagaatgttt |
228 |
Q |
| |
|
|||| |||||| ||||| |
|
|
| T |
25825391 |
caagagagagattgttt |
25825375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University