View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6625_low_44 (Length: 263)
Name: NF6625_low_44
Description: NF6625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6625_low_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 43114048 - 43113924
Alignment:
| Q |
1 |
ttactatttcagtgtttcatctcttcaatgcagaaactccttggttacctaccactactctttcattcattcaaattttgagtttttccacgacccattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43114048 |
ttactatttcagtgtttcatctcttcaatgcagaaactccttggttacctaccactactctttcattcattcaaattttgagtttttccacgacccattt |
43113949 |
T |
 |
| Q |
101 |
tctacgcttactccattcaacgtgg |
125 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
43113948 |
tctacgcttactccattcaacgtgg |
43113924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 215 - 263
Target Start/End: Complemental strand, 43113834 - 43113786
Alignment:
| Q |
215 |
catctatagtactattttttattagatataataatattaaaatttgaac |
263 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43113834 |
catcaatagtactattttttattagatataataatattaaaatttgaac |
43113786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University