View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6625_low_45 (Length: 262)

Name: NF6625_low_45
Description: NF6625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6625_low_45
NF6625_low_45
[»] chr8 (1 HSPs)
chr8 (18-247)||(41160691-41160922)
[»] chr1 (1 HSPs)
chr1 (24-88)||(32656515-32656578)


Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 247
Target Start/End: Complemental strand, 41160922 - 41160691
Alignment:
18 ggttcttggccatgagaaacgatctccactagagtgaacacccgctggataaaagaaaaactgtgaagatatctcttccactttcccagtttcaattctt 117  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
41160922 ggttcttggccatgagaaacgatctccattagagtgaacacccgctggataaaagaaaaactgtgaaaatatctcttccactttcccagtttcaattctt 41160823  T
118 ggtcacatctgatctctatcgatgccagtggatgttggtaataaaattgtgaacaaatttttgcttttcaagagaa--tttttctactataaaaactacc 215  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |  ||||||||||||||||||||||    
41160822 ggtcacatctgatctctatcgatgccagtggatgttggtaataaaattgtgaacaaatttttgcttttcaagaggatttttttctactataaaaactacc 41160723  T
216 aagttaaatataagatgcttgagtaatgaaat 247  Q
    ||||||||||||||||||||||||||||||||    
41160722 aagttaaatataagatgcttgagtaatgaaat 41160691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 88
Target Start/End: Complemental strand, 32656578 - 32656515
Alignment:
24 tggccatgagaaacgatctccactagagtgaacacccgctggataaaagaaaaactgtgaagata 88  Q
    ||||||||||||| ||| ||||||||||||| || |||| |||| |||| |||||||||||||||    
32656578 tggccatgagaaatgatttccactagagtgacca-ccgccggattaaaggaaaactgtgaagata 32656515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University