View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6625_low_54 (Length: 236)
Name: NF6625_low_54
Description: NF6625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6625_low_54 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 47 - 222
Target Start/End: Complemental strand, 34969474 - 34969299
Alignment:
| Q |
47 |
gttggcaacagagggatcgaatattttaaatcttcagtttgctgacgaaattgtaattgtagatgaaaaaagttgggctagtatccgagcattgaaagca |
146 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
34969474 |
gttggcaacagagggatcaaatattttaaatcttcagtttgctgacgacattgtaattgtagatgaaaaaagttgggctaatattcgagcattgaaagca |
34969375 |
T |
 |
| Q |
147 |
aactttgttctctctgaagttgtttcgggtttgaatgtaaacttcaatagaagtttgttaattgggatgaatgttt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34969374 |
aactttgttctctctgaagttgtttcgggtttgaatgtaaacttcaatagaagtttgttaattgggatgaatgttt |
34969299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University