View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6625_low_54 (Length: 236)

Name: NF6625_low_54
Description: NF6625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6625_low_54
NF6625_low_54
[»] chr7 (1 HSPs)
chr7 (47-222)||(34969299-34969474)


Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 47 - 222
Target Start/End: Complemental strand, 34969474 - 34969299
Alignment:
47 gttggcaacagagggatcgaatattttaaatcttcagtttgctgacgaaattgtaattgtagatgaaaaaagttgggctagtatccgagcattgaaagca 146  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |||||||||||||||    
34969474 gttggcaacagagggatcaaatattttaaatcttcagtttgctgacgacattgtaattgtagatgaaaaaagttgggctaatattcgagcattgaaagca 34969375  T
147 aactttgttctctctgaagttgtttcgggtttgaatgtaaacttcaatagaagtttgttaattgggatgaatgttt 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34969374 aactttgttctctctgaagttgtttcgggtttgaatgtaaacttcaatagaagtttgttaattgggatgaatgttt 34969299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University