View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6626_low_20 (Length: 266)
Name: NF6626_low_20
Description: NF6626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6626_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 51196116 - 51196332
Alignment:
| Q |
1 |
aatgtcttaaggtttttggtgaagatgttgtgtctctctttcacttgcgtgattactcttggtccaatggaaaagatctacgagatttccgtcataacct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||||||||| ||||||||| |
|
|
| T |
51196116 |
aatgtcttaaggtttttggtgaagatgtcttgtctctctctcacttgcgtgattacttttggtccaatgtaaaagatccacgagatttccctcataacct |
51196215 |
T |
 |
| Q |
101 |
aacaaaaattgatttaaaattcatttccctttcttcttcctccctcgtatgaatacaccagttatcatcacttgtgtgagtttgaaatttagacgatgca |
200 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51196216 |
aacaaaaattgatttaaaattgatttctctttcttcttcctccctcgtatgaatacaccggttatcatcacttgtgtgagtttgaaatttagacgatgca |
51196315 |
T |
 |
| Q |
201 |
attagacatcttaaaag |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
51196316 |
attagacatcttaaaag |
51196332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University