View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6626_low_21 (Length: 260)
Name: NF6626_low_21
Description: NF6626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6626_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 81 - 250
Target Start/End: Complemental strand, 37734045 - 37733876
Alignment:
| Q |
81 |
agttttcttccgcccgcgcatctatcacacaacgaaagcgcgttaccgagcctagcaccggaggctttccacggtgtcggagattgacaagcgtgacaga |
180 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
37734045 |
agttttcttccgccggcgcatctatcacacaacgaaagcgcgttaccgagcctagcaccggaggctttccacggcgtgggagattgacaagcgtgacaga |
37733946 |
T |
 |
| Q |
181 |
ggagagttctcatgtgtctctcaaccaaaaagttagcagcgtggaccttagaatcgcagtcccagtataa |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37733945 |
ggagagttctcatgtgtctctcaaccaaaaagttagcagcgtggaccttagaatcgcagtcccagcataa |
37733876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University