View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6626_low_25 (Length: 246)
Name: NF6626_low_25
Description: NF6626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6626_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 233
Target Start/End: Complemental strand, 44604663 - 44604448
Alignment:
| Q |
18 |
ctatcttcagtttcttcagccacaggcttcgaaacagtttgatttttagcagcttctatggagacatacagagtgttagcaacnnnnnnntggtatcaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
44604663 |
ctatcttcagtttcttcagccacaggcttcgaaacagtttgatttttagcagcttctatggagacatacagagtgttaacaacaaaaaaatggtatcaag |
44604564 |
T |
|
| Q |
118 |
taattacacaaattccaagcatatagaagtacaaactagcaataaaatgcaaatctcaccaggattacaaagctgcctcctgattgcatcaaaacgctct |
217 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44604563 |
taattacacaaattccaagtatatagaagtacaaactagcaataaaatgcaaatctcaccaggattacaaagctgcctcctgattgcatcaaaacgctct |
44604464 |
T |
|
| Q |
218 |
gcttgttctctctgct |
233 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
44604463 |
gcttgttctctctgct |
44604448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University