View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6626_low_30 (Length: 205)

Name: NF6626_low_30
Description: NF6626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6626_low_30
NF6626_low_30
[»] chr3 (3 HSPs)
chr3 (1-185)||(7675053-7675237)
chr3 (12-185)||(7659426-7659599)
chr3 (12-185)||(7624086-7624259)


Alignment Details
Target: chr3 (Bit Score: 181; Significance: 5e-98; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 7675237 - 7675053
Alignment:
1 cataggtttcagccaaggttgcaagagattggtgtggtgcagggccaaggtgtggtaagttacctattattggccatggttttggtccaggtgggagtgg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7675237 cataggtttcagccaaggttgcaagagattggtgtggtgcagggccaaggtgtggtaagttacctattattggccatggttttggtccaggtgggagtgg 7675138  T
101 tagtgatgaagttcttgttgcaaacttcaccagacggtatattaagattgataatatgcaactagagaatgcaatgagccataga 185  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
7675137 tagtgatgaagttcttgttgcaaacttcaccaaacggtatattaagattgataatatgcaactagagaatgcaatgagccataga 7675053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 12 - 185
Target Start/End: Complemental strand, 7659599 - 7659426
Alignment:
12 gccaaggttgcaagagattggtgtggtgcagggccaaggtgtggtaagttacctattattggccatggttttggtccaggtgggagtggtagtgatgaag 111  Q
    ||||||| ||||| ||| |||||||| ||||| || | |||||| | |||||||||||| ||||||||||||||||||||||| ||||||||||||||||    
7659599 gccaaggctgcaatagactggtgtggggcaggacccaagtgtggcatgttacctattataggccatggttttggtccaggtggaagtggtagtgatgaag 7659500  T
112 ttcttgttgcaaacttcaccagacggtatattaagattgataatatgcaactagagaatgcaatgagccataga 185  Q
     |||| ||||||| ||||  | ||||||||| | |||  ||||| || ||||||  |||||||||| |||||||    
7659499 atctttttgcaaatttcataaaacggtatatgaggatgcataatgtgaaactagctaatgcaatgaaccataga 7659426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 12 - 185
Target Start/End: Original strand, 7624086 - 7624259
Alignment:
12 gccaaggttgcaagagattggtgtggtgcagggccaaggtgtggtaagttacctattattggccatggttttggtccaggtgggagtggtagtgatgaag 111  Q
    ||||||| ||||| ||| |||||||| ||||| || | |||||| | |||||||||||| ||||||||||||||||||||||| ||||||||||||||||    
7624086 gccaaggctgcaatagactggtgtggggcaggacccaagtgtggcatgttacctattataggccatggttttggtccaggtggaagtggtagtgatgaag 7624185  T
112 ttcttgttgcaaacttcaccagacggtatattaagattgataatatgcaactagagaatgcaatgagccataga 185  Q
     |||| ||||||| ||||  | ||||||||| | |||  ||||| || ||||||  | |||||||| |||||||    
7624186 atctttttgcaaatttcataaaacggtatatgaggatgcataatgtgaaactagctattgcaatgaaccataga 7624259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University