View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6629_high_7 (Length: 243)

Name: NF6629_high_7
Description: NF6629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6629_high_7
NF6629_high_7
[»] chr6 (3 HSPs)
chr6 (16-230)||(14226711-14226925)
chr6 (124-230)||(14221232-14221338)
chr6 (124-220)||(14221698-14221794)
[»] chr8 (1 HSPs)
chr8 (63-104)||(2954443-2954484)


Alignment Details
Target: chr6 (Bit Score: 159; Significance: 9e-85; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 16 - 230
Target Start/End: Original strand, 14226711 - 14226925
Alignment:
16 agaatcaacttgttgttgctccggcaacacccaaacaagtggaatatgagcccttggtttggcttggtgggagagtgggagcaagatccaatgtttgttc 115  Q
    |||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| | ||||| || |||||||||||||||||| |||     
14226711 agaatcaacttgttgttgctccggcaacacccaaacaagtggaaaaagagcccttggtttggcttcgcgggagggtaggagcaagatccaatgttggttt 14226810  T
116 gtgttatatatagaagctgagaacaagtctcacattgcaaatgaatgagtagaatattggattaataagagagatgtctcgttaacctaatgtcttaagg 215  Q
    ||||||||||||||||||||||||||||||||| | ||||||||||||||| | ||||||||| |||||||||||||||||||||||||||||||||||     
14226811 gtgttatatatagaagctgagaacaagtctcacgtcgcaaatgaatgagtacagtattggatttataagagagatgtctcgttaacctaatgtcttaaga 14226910  T
216 ttttggatagagatg 230  Q
    |||||||||||||||    
14226911 ttttggatagagatg 14226925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 124 - 230
Target Start/End: Original strand, 14221232 - 14221338
Alignment:
124 tatagaagctgagaacaagtctcacattgcaaatgaatgagtagaatattggattaataagagagatgtctcgttaacctaatgtcttaaggttttggat 223  Q
    ||||| || |||||||||||||||||| ||| ||||||||||  ||| ||||||| ||||||||| || ||| |||| ||||||| ||||||||||||||    
14221232 tataggaggtgagaacaagtctcacatcgcatatgaatgagtgcaatgttggatttataagagaggtgactcattaatctaatgtattaaggttttggat 14221331  T
224 agagatg 230  Q
     ||||||    
14221332 ggagatg 14221338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 124 - 220
Target Start/End: Original strand, 14221698 - 14221794
Alignment:
124 tatagaagctgagaacaagtctcacattgcaaatgaatgagtagaatattggattaataagagagatgtctcgttaacctaatgtcttaaggttttg 220  Q
    ||||| || ||||||||||||||||||  || ||||| ||||| ||| ||| ||| || | ||||||| ||| ||||||||||   |||||||||||    
14221698 tataggaggtgagaacaagtctcacatcacatatgaaggagtacaatgttgaatttattaaagagatgactcattaacctaatacattaaggttttg 14221794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 63 - 104
Target Start/End: Complemental strand, 2954484 - 2954443
Alignment:
63 gagcccttggtttggcttggtgggagagtgggagcaagatcc 104  Q
    |||||||||||| |||| |||||| |||||||||||||||||    
2954484 gagcccttggttaggctcggtgggggagtgggagcaagatcc 2954443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University