View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6629_low_4 (Length: 436)

Name: NF6629_low_4
Description: NF6629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6629_low_4
NF6629_low_4
[»] chr5 (4 HSPs)
chr5 (18-419)||(12547225-12547630)
chr5 (18-419)||(12530989-12531394)
chr5 (18-166)||(9866884-9867032)
chr5 (18-175)||(9894397-9894551)
[»] chr8 (6 HSPs)
chr8 (18-173)||(43479900-43480055)
chr8 (31-173)||(38799242-38799384)
chr8 (31-173)||(38822133-38822275)
chr8 (18-173)||(25865447-25865602)
chr8 (18-173)||(26591915-26592070)
chr8 (18-173)||(41943691-41943846)
[»] chr4 (2 HSPs)
chr4 (25-173)||(24860293-24860441)
chr4 (61-173)||(34748502-34748614)
[»] scaffold0197 (1 HSPs)
scaffold0197 (22-173)||(30759-30910)
[»] chr7 (2 HSPs)
chr7 (22-173)||(21317321-21317472)
chr7 (18-173)||(3930187-3930342)
[»] chr2 (4 HSPs)
chr2 (22-173)||(13576095-13576246)
chr2 (19-173)||(34579141-34579295)
chr2 (19-173)||(34584890-34585044)
chr2 (118-173)||(34571802-34571857)
[»] chr1 (1 HSPs)
chr1 (103-175)||(7594907-7594979)


Alignment Details
Target: chr5 (Bit Score: 329; Significance: 0; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 18 - 419
Target Start/End: Original strand, 12547225 - 12547630
Alignment:
Q  18 gatctcacgaagtgcaacagttccaggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgt 117  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||     
T  12547225 gatctcacgaagtgcaacagttcctggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttagtggcaagctgc 12547324  T
Q  118 ttccttggtgcttttccgccggtggatttgcgagctgtttgcttggtacgagccatggcgaattgaggattgaaattagagagagaaagagaaattaagg 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||| ||    
T  12547325 ttccttggtgcttttccgccggtggatttgcgagctgtttgcttggtacgagccatggcgaattgataattgaaattagagagagaaagagaaattaggg 12547424  T
Q  218 tttgtttgtt----ttgatttcaatttgaatttgcgttgagagaggaaagtgtttggtgtaatttataaagggaagattgaaattttaggaggtgaaaat 313  Q
    ||||||||||    |||||||||||||||||||||||||||| ||  ||||||||||||||||||||||||| |||||||||||||| ||||||||||||    
T  12547425 tttgtttgtttgtgttgatttcaatttgaatttgcgttgagaaagataagtgtttggtgtaatttataaaggaaagattgaaattttgggaggtgaaaat 12547524  T
Q  314 aagcgggaattgtgaaaatttgggatttgggatgatgaaaagggaagatcgtgaccgtagatgagagggcttatcgacggctgttattctctagaacgaa 413  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |||||| |||||||    
T  12547525 aagcgggaattgtgaaaatttgggatttgggatgatgaaaagggaagattgtgaccgtagatgagagggtttatcgacggctgttgttctctggaacgaa 12547624  T
Q  414 gggcac 419  Q
    ||||||    
T  12547625 gggcac 12547630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 18 - 419
Target Start/End: Complemental strand, 12531394 - 12530989
Alignment:
Q  18 gatctcacgaagtgcaacagttccaggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgt 117  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||     
T  12531394 gatctcacgaagtgcaacagttcctggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttagtggcaagctgc 12531295  T
Q  118 ttccttggtgcttttccgccggtggatttgcgagctgtttgcttggtacgagccatggcgaattgaggattgaaattagagagagaaagagaaattaag- 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||| |     
T  12531294 ttccttggtgcttttccgccggtggatttgcgagctgtttgcttggtacgagccatggcgaattgataattgaaattagagagagaaagagaaattaggg 12531195  T
Q  217 ---gtttgtttgttttgatttcaatttgaatttgcgttgagagaggaaagtgtttggtgtaatttataaagggaagattgaaattttaggaggtgaaaat 313  Q
       |||||||||| |||||||||||||||||||||||||||| ||  ||||||||||||||||||||||||| |||||||||||||| ||||||||||||    
T  12531194 tctgtttgtttgtgttgatttcaatttgaatttgcgttgagaaagataagtgtttggtgtaatttataaaggaaagattgaaattttgggaggtgaaaat 12531095  T
Q  314 aagcgggaattgtgaaaatttgggatttgggatgatgaaaagggaagatcgtgaccgtagatgagagggcttatcgacggctgttattctctagaacgaa 413  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |||||| |||||||    
T  12531094 aagcgggaattgtgaaaatttgggatttgggatgatgaaaagggaagattgtgaccgtagatgagagggtttatcgacggctgttgttctctggaacgaa 12530995  T
Q  414 gggcac 419  Q
    ||||||    
T  12530994 gggcac 12530989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 18 - 166
Target Start/End: Original strand, 9866884 - 9867032
Alignment:
Q  18 gatctcacgaagtgcaacagttccaggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgt 117  Q
    |||||||||||| ||||| |||||||||||||| | |||||||||||| |||||||| ||||||||||| |||||||| |||||||| ||||| ||||      
T  9866884 gatctcacgaagcgcaacggttccaggacggaaacggtgtggcttcttcactcctcccgttgccggagctgatttccgagcagcttttgtggccagcttc 9866983  T
Q  118 ttccttggtgcttttccgccggtggatttgcgagctgtttgcttggtac 166  Q
    || | ||||||||| |||||||||||||||||||| ||||| |||||||    
T  9866984 tttcatggtgctttaccgccggtggatttgcgagccgtttgtttggtac 9867032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 18 - 175
Target Start/End: Complemental strand, 9894551 - 9894397
Alignment:
Q  18 gatctcacgaagtgcaacagttccaggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgt 117  Q
    |||||||||||| ||||| |||||| |||  ||   |||||||||||| |||  ||||| |||| |||| ||||| || || |||||||||||||||||     
T  9894551 gatctcacgaagagcaaccgttccatgacaaaaatggtgtggcttcttcactgttccggctgccagagctgattttcgagcggctttggtggcaagctgc 9894452  T
Q  118 ttccttggtgcttttccgccggtggatttgcgagctgtttgcttggtacgagccatgg 175  Q
    || | ||||||||| ||||| ||    ||||| ||||||||||||||||  |||||||    
T  9894451 tttcgtggtgctttgccgccagt---attgcgtgctgtttgcttggtacctgccatgg 9894397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 104; Significance: 1e-51; HSPs: 6)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 18 - 173
Target Start/End: Original strand, 43479900 - 43480055
Alignment:
Q  18 gatctcacgaagtgcaacagttccaggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgt 117  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |||||||| || ||||||||||| || |||    
T  43479900 gatctcacgaagagcaacagttccaggacggaatctgtgtggcttcttcactcctccggtggccggagctgatttccgagcggctttggtggcgagttgt 43479999  T
Q  118 ttccttggtgcttttccgccggtggatttgcgagctgtttgcttggtacgagccat 173  Q
    |||||||| ||||| || ||||||||||||||||| ||||| ||||||||||||||    
T  43480000 ttccttggagctttgccaccggtggatttgcgagcggtttgtttggtacgagccat 43480055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 31 - 173
Target Start/End: Complemental strand, 38799384 - 38799242
Alignment:
Q  31 gcaacagttccaggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgtttccttggtgctt 130  Q
    |||||||||||||| | |||||| ||||||||||| ||||||||||| |||||||| |||||||| || || |||||||| ||||| ||||  || || |    
T  38799384 gcaacagttccaggtctgaatctatgtggcttcttcactcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagcct 38799285  T
Q  131 ttccgccggtggatttgcgagctgtttgcttggtacgagccat 173  Q
    | ||||||||||||||||||||||||||||||||||| |||||    
T  38799284 tgccgccggtggatttgcgagctgtttgcttggtacgtgccat 38799242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 31 - 173
Target Start/End: Original strand, 38822133 - 38822275
Alignment:
Q  31 gcaacagttccaggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgtttccttggtgctt 130  Q
    |||||||||||||| | |||||| ||||||||||| ||||||||||| |||||||| |||||||| || || |||||||| ||||| ||||  || || |    
T  38822133 gcaacagttccaggtctgaatctatgtggcttcttcactcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagcct 38822232  T
Q  131 ttccgccggtggatttgcgagctgtttgcttggtacgagccat 173  Q
    | ||||||||||||||||||||||||||||||||||| |||||    
T  38822233 tgccgccggtggatttgcgagctgtttgcttggtacgtgccat 38822275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 18 - 173
Target Start/End: Complemental strand, 25865602 - 25865447
Alignment:
Q  18 gatctcacgaagtgcaacagttccaggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgt 117  Q
    |||||||||||| ||||| |||||||||||  | |  || |||||||| ||||| ||||| |  |||||||||||||  ||||||||||| || || ||     
T  25865602 gatctcacgaagagcaacggttccaggacgataacgatgaggcttcttcactccgccggtggttggagcagatttccttgcagctttggtcgcgagttgc 25865503  T
Q  118 ttccttggtgcttttccgccggtggatttgcgagctgtttgcttggtacgagccat 173  Q
    ||||||||||| || |||||||||||||||||||| |||||||| |||||||||||    
T  25865502 ttccttggtgccttgccgccggtggatttgcgagcagtttgcttcgtacgagccat 25865447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 18 - 173
Target Start/End: Complemental strand, 26592070 - 26591915
Alignment:
Q  18 gatctcacgaagtgcaacagttccaggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgt 117  Q
    ||||||||| ||||| || ||||| || | ||| | |||||||||||| ||||| ||||| |||||||| |||||||| || ||||| || || |||||     
T  26592070 gatctcacggagtgcgacggttcctggcctgaaacggtgtggcttcttcactccgccggtcgccggagcggatttccgagcggcttttgttgcgagctgc 26591971  T
Q  118 ttccttggtgcttttccgccggtggatttgcgagctgtttgcttggtacgagccat 173  Q
    |||||||||||||| ||||||||||| ||||| || |||||||| ||||| |||||    
T  26591970 ttccttggtgctttgccgccggtggacttgcgtgcagtttgcttagtacgtgccat 26591915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 18 - 173
Target Start/End: Complemental strand, 41943846 - 41943691
Alignment:
Q  18 gatctcacgaagtgcaacagttccaggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgt 117  Q
    |||||||||||||||||| || ||||||||  | |  || || ||||||||||| |||||||  ||||||||||| || ||||| |||||||| || ||     
T  41943846 gatctcacgaagtgcaacggtaccaggacgatagcgatgaggtttcttgactccaccggttgtaggagcagatttgcgagcagccttggtggccagttgc 41943747  T
Q  118 ttccttggtgcttttccgccggtggatttgcgagctgtttgcttggtacgagccat 173  Q
    |||||||| || || || ||||||||||||||||| |||||||| |||||||||||    
T  41943746 ttccttggagccttgccaccggtggatttgcgagcagtttgcttagtacgagccat 41943691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 77; Significance: 1e-35; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 25 - 173
Target Start/End: Complemental strand, 24860441 - 24860293
Alignment:
Q  25 cgaagtgcaacagttccaggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgtttccttg 124  Q
    ||||||||||| ||||| |||||||| | ||| || ||||| ||||| ||||| || ||||| ||||||||||| ||||| || || ||||| |||||||    
T  24860441 cgaagtgcaacggttccgggacggaaacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgcttccttg 24860342  T
Q  125 gtgcttttccgccggtggatttgcgagctgtttgcttggtacgagccat 173  Q
    |||||||||| |||||||||||||||||||||||||| |||||||||||    
T  24860341 gtgcttttcctccggtggatttgcgagctgtttgctttgtacgagccat 24860293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 61 - 173
Target Start/End: Complemental strand, 34748614 - 34748502
Alignment:
Q  61 ttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgtttccttggtgcttttccgccggtggatttgcgagctgtttgct 160  Q
    ||||| ||||| ||||| |||||||||||||| || || ||||| ||||| || || |||||||| ||||| || || |||||||||||||| |||||||    
T  34748614 ttcttcactccaccggtggccggagcagatttgcgagcggcttttgtggctagttgcttccttggagctttacctccagtggatttgcgagcggtttgct 34748515  T
Q  161 tggtacgagccat 173  Q
    ||||||| |||||    
T  34748514 tggtacgtgccat 34748502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0197 (Bit Score: 76; Significance: 5e-35; HSPs: 1)
Name: scaffold0197
Description:

Target: scaffold0197; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 22 - 173
Target Start/End: Complemental strand, 30910 - 30759
Alignment:
Q  22 tcacgaagtgcaacagttccaggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgtttcc 121  Q
    |||||||| || || ||||| |||||||| | |||||||||||| ||||||||||| |||||||| |||||||| || ||||||||||| || ||||| |    
T  30910 tcacgaagcgccacggttccgggacggaaacggtgtggcttcttcactcctccggtcgccggagctgatttccgtgcggctttggtggcgagttgtttgc 30811  T
Q  122 ttggtgcttttccgccggtggatttgcgagctgtttgcttggtacgagccat 173  Q
     ||| ||||||||||||||||||||||| |||||||| |||||||| |||||    
T  30810 gtggggcttttccgccggtggatttgcgtgctgtttgtttggtacgtgccat 30759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 76; Significance: 5e-35; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 22 - 173
Target Start/End: Complemental strand, 21317472 - 21317321
Alignment:
Q  22 tcacgaagtgcaacagttccaggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgtttcc 121  Q
    |||||||| || || ||||| |||||||| | |||||||||||| ||||||||||| |||||||| |||||||| || ||||||||||| || ||||| |    
T  21317472 tcacgaagcgccacggttccgggacggaaacggtgtggcttcttcactcctccggtcgccggagctgatttccgtgcggctttggtggcgagttgtttgc 21317373  T
Q  122 ttggtgcttttccgccggtggatttgcgagctgtttgcttggtacgagccat 173  Q
     ||| ||||||||||||||||||||||| |||||||| |||||||| |||||    
T  21317372 gtggggcttttccgccggtggatttgcgtgctgtttgtttggtacgtgccat 21317321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 18 - 173
Target Start/End: Original strand, 3930187 - 3930342
Alignment:
Q  18 gatctcacgaagtgcaacagttccaggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgt 117  Q
    ||||||||||||||| || ||||| ||||||||||||||||| ||||| || || ||||||||||| || ||||| |  || ||||||||||| || |||    
T  3930187 gatctcacgaagtgcgactgttcctggacggaatctgtgtggtttctttacaccaccggttgccggtgctgattttcttgcggctttggtggcgagttgt 3930286  T
Q  118 ttccttggtgcttttccgccggtggatttgcgagctgtttgcttggtacgagccat 173  Q
    |||| ||| |||||||| ||||||||||| || |||||||| |||||||| |||||    
T  3930287 ttccgtggggcttttcctccggtggattttcgtgctgtttgtttggtacgtgccat 3930342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 76; Significance: 5e-35; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 22 - 173
Target Start/End: Complemental strand, 13576246 - 13576095
Alignment:
Q  22 tcacgaagtgcaacagttccaggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgtttcc 121  Q
    |||||||| || || |||||||||||||| |  ||||||||||| ||||||||||| |||||||| |||||||| || ||||| ||||| || ||||| |    
T  13576246 tcacgaagagcgacggttccaggacggaaacgatgtggcttcttcactcctccggtggccggagcggatttccgagcggcttttgtggcgagttgtttgc 13576147  T
Q  122 ttggtgcttttccgccggtggatttgcgagctgtttgcttggtacgagccat 173  Q
     ||||||||||||||||||||||||||| |||||||| |||||||| |||||    
T  13576146 gtggtgcttttccgccggtggatttgcgggctgtttgtttggtacgtgccat 13576095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 19 - 173
Target Start/End: Original strand, 34579141 - 34579295
Alignment:
Q  19 atctcacgaagtgcaacagttccaggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgtt 118  Q
    ||||||||||| ||||| |||||||||||  | |  || |||||||||| ||| |||||||  ||  ||||||| || ||||| || ||||| || || |    
T  34579141 atctcacgaagagcaactgttccaggacgataacgatgaggcttcttgattccgccggttgttggcacagattttcgagcagcctttgtggcgagttgct 34579240  T
Q  119 tccttggtgcttttccgccggtggatttgcgagctgtttgcttggtacgagccat 173  Q
    |||||||||| || ||   ||||||| ||||||| |||||||| ||||| |||||    
T  34579241 tccttggtgccttaccaagggtggatctgcgagcagtttgctttgtacgcgccat 34579295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 19 - 173
Target Start/End: Original strand, 34584890 - 34585044
Alignment:
Q  19 atctcacgaagtgcaacagttccaggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgtt 118  Q
    ||||||||||| ||||| |||||||||||  | |  || |||||||||| ||| |||||||  ||  ||||||| || ||||| || ||||| || || |    
T  34584890 atctcacgaagagcaactgttccaggacgataacgatgaggcttcttgattccgccggttgttggcacagattttcgagcagcctttgtggcgagttgct 34584989  T
Q  119 tccttggtgcttttccgccggtggatttgcgagctgtttgcttggtacgagccat 173  Q
    |||||||||| || ||   ||||||| ||||||| |||||||| ||||| |||||    
T  34584990 tccttggtgccttaccaagggtggatctgcgagcagtttgctttgtacgcgccat 34585044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 118 - 173
Target Start/End: Original strand, 34571802 - 34571857
Alignment:
Q  118 ttccttggtgcttttccgccggtggatttgcgagctgtttgcttggtacgagccat 173  Q
    ||||||||||| || || ||||||||||||||||| |||||||| ||||| |||||    
T  34571802 ttccttggtgccttgccaccggtggatttgcgagcagtttgctttgtacgcgccat 34571857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 175
Target Start/End: Original strand, 7594907 - 7594979
Alignment:
Q  103 ttggtggcaagctgtttccttggtgcttttccgccggtggatttgcgagctgtttgcttggtacgagccatgg 175  Q
    |||||||| ||||| |||||||| || || || ||||| || |||||||| ||||||||||||||||||||||    
T  7594907 ttggtggcgagctgcttccttggagccttaccaccggtagacttgcgagcggtttgcttggtacgagccatgg 7594979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University