View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6629_low_8 (Length: 250)
Name: NF6629_low_8
Description: NF6629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6629_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 57; Significance: 7e-24; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 172 - 228
Target Start/End: Complemental strand, 45342796 - 45342740
Alignment:
| Q |
172 |
ggtaatttacaagctctgtgtattgtctggtgtgaccattgtctgggatataaacgg |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45342796 |
ggtaatttacaagctctgtgtattgtctggtgtgaccattgtctgggatataaacgg |
45342740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 14 - 58
Target Start/End: Complemental strand, 45342964 - 45342920
Alignment:
| Q |
14 |
tagcaaaggtgggtggtagggaaatcagaagcgtcgtctcagggt |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45342964 |
tagcaaaggtgggtggtagggaaatcagaagcgtcgtctcagggt |
45342920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University