View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6630_low_19 (Length: 238)
Name: NF6630_low_19
Description: NF6630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6630_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 41952690 - 41952914
Alignment:
| Q |
1 |
tgtttctcgtaaatctgtgctccccaacgtccgttaggctgtggcaccacgcctttgtatttcgacgatggaagtttacgagactccgcctcgccggaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41952690 |
tgtttctcgtaaatctgtgctccccaacgtccgttaggctgtggcaccacgcctttgtatttcgacgatggaagtttacgagactccgcctcaccggaga |
41952789 |
T |
 |
| Q |
101 |
cgccgtagatttctggatccacgacggagctagcaccactgccaacgcggcttagtgagttcaacgttggcggcggtgtagataagttcgccgaaagaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41952790 |
cgccgtagatttctggatccacgacggagctagcagcactgccaacgcggcttagtgagttcagcgttggcggcggtgtagataagttcgccgaaagaga |
41952889 |
T |
 |
| Q |
201 |
gtcattgcttgtgacagtttcatct |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
41952890 |
gtcattgcttgtgacagtttcatct |
41952914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 95
Target Start/End: Complemental strand, 22189839 - 22189751
Alignment:
| Q |
7 |
tcgtaaatctgtgctccccaacgtccgttaggctgtggcaccacgcctttgtatttcgacgatggaagtttacgagactccgcctcgcc |
95 |
Q |
| |
|
||||||||||||||||||||||| || || || ||||| || || |||||||| ||||| || ||||| || || ||||| || ||||| |
|
|
| T |
22189839 |
tcgtaaatctgtgctccccaacgaccatttggttgtggtacaacacctttgtacttcgaagaaggaagcttccgtgactcagcttcgcc |
22189751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University