View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6631_low_3 (Length: 278)
Name: NF6631_low_3
Description: NF6631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6631_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 62 - 267
Target Start/End: Original strand, 50044622 - 50044827
Alignment:
| Q |
62 |
gcctagaagagtattggtgattaaaatttaaaaaaggatatacctcgtcttccaaatcactcagaaattctgttacatacggtatttcttccagcacccc |
161 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50044622 |
gcctagaagagtattggtgattaaaattttaaaaaggatatacctcgtcttccaaatcactcagaaattctgttacatacggtatttcttccagcacccc |
50044721 |
T |
|
| Q |
162 |
gccttttaggcccttcataaactgagtagaacaaaaaacaaacattaatataaagagatatggacttgtggacatgaagtttgtatgaagggaatttggt |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50044722 |
gccttttaggcccttcataaactgagtagaacaaaaaacaaacattaatataaagagatatggacttgtggacatgaagtttgtatgaagggaatttggt |
50044821 |
T |
|
| Q |
262 |
catatt |
267 |
Q |
| |
|
|||||| |
|
|
| T |
50044822 |
catatt |
50044827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 19 - 51
Target Start/End: Original strand, 50044573 - 50044605
Alignment:
| Q |
19 |
gctcctcactagatcagtgaagagctttagtga |
51 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
50044573 |
gctcctcactagatcactgaagagctttagtga |
50044605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University