View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6635_high_23 (Length: 299)

Name: NF6635_high_23
Description: NF6635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6635_high_23
NF6635_high_23
[»] chr4 (4 HSPs)
chr4 (10-281)||(17436798-17437061)
chr4 (140-195)||(45716516-45716571)
chr4 (140-195)||(47421499-47421554)
chr4 (141-211)||(8485609-8485679)
[»] chr8 (2 HSPs)
chr8 (115-271)||(13876850-13877005)
chr8 (140-195)||(7927080-7927135)
[»] chr1 (4 HSPs)
chr1 (137-213)||(29306051-29306127)
chr1 (114-195)||(27392151-27392232)
chr1 (119-207)||(44893703-44893791)
chr1 (125-211)||(32350707-32350793)
[»] chr7 (2 HSPs)
chr7 (140-195)||(4935518-4935573)
chr7 (125-211)||(13442737-13442823)
[»] chr3 (1 HSPs)
chr3 (143-274)||(19917625-19917755)
[»] chr6 (1 HSPs)
chr6 (125-211)||(15676504-15676590)
[»] chr5 (2 HSPs)
chr5 (114-183)||(30507387-30507456)
chr5 (114-183)||(30547730-30547799)


Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 10 - 281
Target Start/End: Original strand, 17436798 - 17437061
Alignment:
10 tgtaaattatatattttgagaagatacgaatccaacgatccaaatannnnnnnnnnnnnnnnacaaaatccaaagacccaaatgttgttgagcagatttt 109  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||                ||||||||||||||||||||||||||||||||||||||    
17436798 tgtaaattatatattttgagaagatacgaatccaaagatccaaatatttttttta-------acaaaatccaaagacccaaatgttgttgagcagatttt 17436890  T
110 gaggctttcaatcagttcattgatgaaaatgttttgattgatttacctttttgcgggcgtaagtttacttggttcaagggtgatgggaaatctatgagtc 209  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||    
17436891 gaggctttcaatcagttcattgatgaaaatgttttgattgatttacctttttgcgggcgtaagtttacttggtttaagggtgatggaaaatctatgagtc 17436990  T
210 ggtttggacaaatttttgctctctgaatcgtggtgtttggtgtggctgaattgtgttcaggtggctcatctg 281  Q
    || ||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||    
17436991 gg-ttggacaaatttttgctctctaaatcgtggtatttggtgtggctgaattgtgttcaggtggctcatctg 17437061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 140 - 195
Target Start/End: Complemental strand, 45716571 - 45716516
Alignment:
140 gttttgattgatttacctttttgcgggcgtaagtttacttggttcaagggtgatgg 195  Q
    |||||||||||||||||||| || ||| | |||||||||||||| ||||| |||||    
45716571 gttttgattgatttacctttatgtgggaggaagtttacttggtttaagggggatgg 45716516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 140 - 195
Target Start/End: Complemental strand, 47421554 - 47421499
Alignment:
140 gttttgattgatttacctttttgcgggcgtaagtttacttggttcaagggtgatgg 195  Q
    |||||||||||||||||||| || ||| | |||||||||||||| ||||| |||||    
47421554 gttttgattgatttacctttatgtgggaggaagtttacttggtttaagggggatgg 47421499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 211
Target Start/End: Original strand, 8485609 - 8485679
Alignment:
141 ttttgattgatttacctttttgcgggcgtaagtttacttggttcaagggtgatgggaaatctatgagtcgg 211  Q
    |||||| |||||| |||||  | || ||||||||||||||||| || || ||||||| |||||||||||||    
8485609 ttttgaatgattttcctttgggaggtcgtaagtttacttggtttaaaggggatgggagatctatgagtcgg 8485679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 37; Significance: 0.000000000007; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 115 - 271
Target Start/End: Original strand, 13876850 - 13877005
Alignment:
115 tttcaatcagttcattgatgaaaatgttttgattgatttacctttttgcgggcgtaagtttacttggttcaagggtgatgggaaatctatgagtcggttt 214  Q
    ||||||| |||| || ||||||  ||| ||||||||||||||||| || || || |||||||| ||||| ||||| |||||   |||||||||| || ||    
13876850 tttcaatgagtttatagatgaatgtgtgttgattgatttacctttatgtggccgaaagtttacctggtttaagggggatggtcgatctatgagtagg-tt 13876948  T
215 ggacaaatttttgctctctgaatcgtggtgtttggtgtggctgaattgtgttcaggt 271  Q
    |||||  |||||| | || ||| ||||||| ||| ||||||  |||||| |||||||    
13876949 ggacaggtttttgttatccgaagcgtggtgcttgttgtggccaaattgtattcaggt 13877005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 140 - 195
Target Start/End: Complemental strand, 7927135 - 7927080
Alignment:
140 gttttgattgatttacctttttgcgggcgtaagtttacttggttcaagggtgatgg 195  Q
    |||||||||||||||||||| || ||| | |||||||||||||| ||||| |||||    
7927135 gttttgattgatttacctttatgtgggaggaagtttacttggtttaagggggatgg 7927080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.000000000007; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 137 - 213
Target Start/End: Complemental strand, 29306127 - 29306051
Alignment:
137 aatgttttgattgatttacctttttgcgggcgtaagtttacttggttcaagggtgatgggaaatctatgagtcggtt 213  Q
    ||||| ||||||||||||||| ||   |||||||||||||| |||| |||||||||||| | ||| |||||||||||    
29306127 aatgtgttgattgatttacctcttaatgggcgtaagtttacctggtacaagggtgatggaagatccatgagtcggtt 29306051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 114 - 195
Target Start/End: Original strand, 27392151 - 27392232
Alignment:
114 ctttcaatcagttcattgatgaaaatgttttgattgatttacctttttgcgggcgtaagtttacttggttcaagggtgatgg 195  Q
    ||||||||||||| |||||| ||||||| ||||| ||||||||||| ||| | || |  | ||| |||||||||||||||||    
27392151 ctttcaatcagtttattgattaaaatgtgttgatagatttacctttatgcagccgcagatatacgtggttcaagggtgatgg 27392232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 119 - 207
Target Start/End: Complemental strand, 44893791 - 44893703
Alignment:
119 aatcagttcattgatgaaaatgttttgattgatttacctttttgcgggcgtaagtttacttggttcaagggtgatgggaaatctatgag 207  Q
    ||||||||||||||||  ||| | ||||||||||||||| || | || || |  |||||||| |||||||||||||| || ||||||||    
44893791 aatcagttcattgatggtaatttgttgattgatttacctcttcggggtcgcagttttacttgattcaagggtgatggcaagtctatgag 44893703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 125 - 211
Target Start/End: Original strand, 32350707 - 32350793
Alignment:
125 ttcattgatgaaaatgttttgattgatttacctttttgcgggcgtaagtttacttggttcaagggtgatgggaaatctatgagtcgg 211  Q
    |||||||| ||||||  | ||| |||||| |||||  | || ||||||||||||||||| || || ||||||| |||||||||||||    
32350707 ttcattgacgaaaattctctgaatgatttgcctttgggaggtcgtaagtttacttggtttaaaggggatgggagatctatgagtcgg 32350793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 32; Significance: 0.000000007; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 140 - 195
Target Start/End: Original strand, 4935518 - 4935573
Alignment:
140 gttttgattgatttacctttttgcgggcgtaagtttacttggttcaagggtgatgg 195  Q
    |||||||||||||||||||| || ||| | |||||||||||||| ||||| |||||    
4935518 gttttgattgatttacctttatgtgggaggaagtttacttggtttaagggggatgg 4935573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 125 - 211
Target Start/End: Complemental strand, 13442823 - 13442737
Alignment:
125 ttcattgatgaaaatgttttgattgatttacctttttgcgggcgtaagtttacttggttcaagggtgatgggaaatctatgagtcgg 211  Q
    |||||||| ||||||  | || ||||||| |||||  | || ||||||||||||||||| || || ||||||| |||||||||||||    
13442823 ttcattgacgaaaattctctgcttgatttgcctttgggaggtcgtaagtttacttggtttaaaggggatgggagatctatgagtcgg 13442737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 143 - 274
Target Start/End: Original strand, 19917625 - 19917755
Alignment:
143 ttgattgatttacctttttgcgggcgtaagtttacttggttcaagggtgatgggaaatctatgagtcggtttggacaaatttttgctctctgaatcgtgg 242  Q
    |||||||||||||| || || ||| | |||||||||||||| |||||  ||||    || |||||| |||| ||| |  || ||||||||||||   |||    
19917625 ttgattgatttaccgttatgtgggaggaagtttacttggtttaaggggaatggccgttcgatgagtaggtt-ggataggttcttgctctctgaagattgg 19917723  T
243 tgtttggtgtggctgaattgtgttcaggtggc 274  Q
    |||||||||||||  |||||||||||||||||    
19917724 tgtttggtgtggcctaattgtgttcaggtggc 19917755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 125 - 211
Target Start/End: Complemental strand, 15676590 - 15676504
Alignment:
125 ttcattgatgaaaatgttttgattgatttacctttttgcgggcgtaagtttacttggttcaagggtgatgggaaatctatgagtcgg 211  Q
    |||||||| |||||| || ||| |||||| |||||  | || ||||||||||||||||| |  || ||||||| |||||||||||||    
15676590 ttcattgacgaaaattttctgaatgatttgcctttgggaggtcgtaagtttacttggtttagaggggatgggagatctatgagtcgg 15676504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 114 - 183
Target Start/End: Original strand, 30507387 - 30507456
Alignment:
114 ctttcaatcagttcattgatgaaaatgttttgattgatttacctttttgcgggcgtaagtttacttggtt 183  Q
    |||| ||||| ||||| || ||||||| |||| |||||||||| || || |||||||| |||||||||||    
30507387 cttttaatcaattcatagaggaaaatggtttgcttgatttaccgttgtgtgggcgtaattttacttggtt 30507456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 114 - 183
Target Start/End: Original strand, 30547730 - 30547799
Alignment:
114 ctttcaatcagttcattgatgaaaatgttttgattgatttacctttttgcgggcgtaagtttacttggtt 183  Q
    |||| ||||| ||||| || ||||||| |||| |||||||||| || || |||||||| |||||||||||    
30547730 cttttaatcaattcatagaggaaaatggtttgcttgatttaccgttgtgtgggcgtaattttacttggtt 30547799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University