View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6635_high_28 (Length: 257)
Name: NF6635_high_28
Description: NF6635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6635_high_28 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 13 - 257
Target Start/End: Original strand, 45103724 - 45103968
Alignment:
| Q |
13 |
actaaaagggataaagtaagaaaaactaaacagaatgctactggtaaaatataagaatgcttcattctcaacaaacaaatattgaagccaaaactaccta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45103724 |
actaaaagggataaagtaagaaaaactacacagaatgctactggtaaaatataagaatgcttcattctcaacaaacaaatattgaagccaaaactaccta |
45103823 |
T |
|
| Q |
113 |
gtctctattctctataaaacttgaaaacttaagaaggtactataagcactacaacacacacaagttgcaagttgcaacaattttaactaaatttagcttt |
212 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45103824 |
gtctctattctccataaaacttgaaaacttaagaaggtactataagcactacaacacaaacaagttgcaagttgcaacaattttaactaaatttagcttt |
45103923 |
T |
|
| Q |
213 |
tggagtgcatgcagaatcaaaagtgcaagttactatatatttatt |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45103924 |
tggagtgcatgcagaatcaaaagtgcaagttactatatatttatt |
45103968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University