View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6635_low_19 (Length: 335)
Name: NF6635_low_19
Description: NF6635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6635_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 1 - 327
Target Start/End: Complemental strand, 6119512 - 6119186
Alignment:
| Q |
1 |
tggtgctcgtccggttcatttctcccaaacggttcactcttacaaaccggtggtgatttagacgggtttaaaaagatccgaatattcaacccgtgtgatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6119512 |
tggtgctcgtccggttcatttctcccaaacggttcactcttacaaaccggtggtgatttagacgggtttaaaaagatccgaatattcaacccgtgtgatt |
6119413 |
T |
 |
| Q |
101 |
caaccgggtcttgcgattgggaagagttaaacgacgtcgaattaagcgaaggtcgttggtatgcgacgaatcaaattcttccagatggttctgtcatcat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6119412 |
caaccgggtcttgcgattgggaagagttaaacgacgtcgaattaagcgaaggtcgttggtatgcgacgaatcaaattcttccagatggttccatcatcat |
6119313 |
T |
 |
| Q |
201 |
catcggtggaagaggttcaaacacagttgaattttacccgaaacgtgaaaatggtgtcgttttgtttccgtttctgcaagaaactgaagatacacaaatg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6119312 |
catcggtggaagaggttcaaacacagttgaattttacccgaaacgcgaaaacggtgtcgttttgtttccgtttctacaagaaactgaagatacacaaatg |
6119213 |
T |
 |
| Q |
301 |
gataatttatacccgtatgttcatctc |
327 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
6119212 |
gataatttatacccgtatgttcatctc |
6119186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University