View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6635_low_33 (Length: 253)
Name: NF6635_low_33
Description: NF6635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6635_low_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 30 - 142
Target Start/End: Complemental strand, 4329017 - 4328905
Alignment:
| Q |
30 |
ttaactcacgctcacaccggttttgtcacacatggtgtggctaggggaatgtgcaatgctattgattccactaaaaagtagtggtggggcagcagtgcat |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4329017 |
ttaactcacgctcacaccggttttgtcacacatggtgtggctaggggaatgtgcaatgctattgattccactaaaaagtagtggtggggcagcggtgcat |
4328918 |
T |
|
| Q |
130 |
gatggcatggcat |
142 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4328917 |
gatggcatggcat |
4328905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 142 - 243
Target Start/End: Complemental strand, 4325454 - 4325353
Alignment:
| Q |
142 |
ttgattcataagagagtggcccaaatagagctttacacacaaatgtacaattaatgcgccatgatgatcttgttttcacactgaacttacctaatgatga |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4325454 |
ttgattcataagagagtggcccaaatagagctttacacacaaatgtacaattaatgtgccatgatgatcttgttttcacactgaacttacctaatgatga |
4325355 |
T |
|
| Q |
242 |
tg |
243 |
Q |
| |
|
|| |
|
|
| T |
4325354 |
tg |
4325353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 88 - 120
Target Start/End: Complemental strand, 48225278 - 48225246
Alignment:
| Q |
88 |
ctattgattccactaaaaagtagtggtggggca |
120 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
48225278 |
ctattgattccaataaaaagtagtggtggggca |
48225246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University