View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6635_low_35 (Length: 247)

Name: NF6635_low_35
Description: NF6635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6635_low_35
NF6635_low_35
[»] chr1 (1 HSPs)
chr1 (94-228)||(17812262-17812396)


Alignment Details
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 94 - 228
Target Start/End: Original strand, 17812262 - 17812396
Alignment:
94 tctgcttcttccaaaacgtaccaacttagtttgggaattatttcaagatgtacatgacaggaatgtcaagtgggttggaggctccagttttgttctaatt 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||    
17812262 tctgcttcttccaaaacgtaccaacttagtttgggaattatttcaagatgtgtatgacaggaatgtcaagtgggttggaggctccagttttgttctaatt 17812361  T
194 tatgttatctatgattttaatatttttagatatca 228  Q
    ||||||||||||| |||||||||||||||||||||    
17812362 tatgttatctatggttttaatatttttagatatca 17812396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University