View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6635_low_35 (Length: 247)
Name: NF6635_low_35
Description: NF6635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6635_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 94 - 228
Target Start/End: Original strand, 17812262 - 17812396
Alignment:
| Q |
94 |
tctgcttcttccaaaacgtaccaacttagtttgggaattatttcaagatgtacatgacaggaatgtcaagtgggttggaggctccagttttgttctaatt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17812262 |
tctgcttcttccaaaacgtaccaacttagtttgggaattatttcaagatgtgtatgacaggaatgtcaagtgggttggaggctccagttttgttctaatt |
17812361 |
T |
 |
| Q |
194 |
tatgttatctatgattttaatatttttagatatca |
228 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
17812362 |
tatgttatctatggttttaatatttttagatatca |
17812396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University