View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6635_low_38 (Length: 237)
Name: NF6635_low_38
Description: NF6635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6635_low_38 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 15 - 218
Target Start/End: Original strand, 6471779 - 6471982
Alignment:
| Q |
15 |
aaagggtaggttaattgtcattggtgttttgagaaattttcaagtattagcctatcgtgtaccctaaaacttgcctaagattgagtagtatccaatgctg |
114 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6471779 |
aaagggtaggttaattgtcattgatgttttgagaaattttcaagtattagcctatcgtgtaccctaaaacttgcctaagattgagtagtatctaatgctg |
6471878 |
T |
|
| Q |
115 |
aaaatactaagaatctaacacacaaattgcactcaccacataccttaaaaaactataaaaccacaataataattaagacattcatcattatcctatcagc |
214 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6471879 |
aaaatactaagaatctaacacaaaaattgcactcaccacataccttaaaaaactataaaaccacaatcataattaagacattcatcattatcctatcagc |
6471978 |
T |
|
| Q |
215 |
tgca |
218 |
Q |
| |
|
|||| |
|
|
| T |
6471979 |
tgca |
6471982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 25 - 106
Target Start/End: Original strand, 13034930 - 13035011
Alignment:
| Q |
25 |
ttaattgtcattggtgttttgagaaattttcaagtattagcctatcgtgtaccctaaaacttgcctaagattgagtagtatc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
13034930 |
ttaattgtcattggtgttttgagaaatttttaagtattagcctatcgtgtaccgtaaaacttgcctaagattgagttgtatc |
13035011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University