View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6635_low_41 (Length: 233)
Name: NF6635_low_41
Description: NF6635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6635_low_41 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 41796894 - 41797112
Alignment:
| Q |
1 |
acatgaatgaatggatttccaacacttaccaatgtaccgaccgcgtgaatgcggggattacctatcacaacctatcccaattctaaactctaaacttaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41796894 |
acatgaatgaatggatttccaacacttaccaatgtaccgaccgcgtgaatacggggattacctatcacaacctatcccaattctaaactctaaacttaaa |
41796993 |
T |
|
| Q |
101 |
ggtatctttcatctagaagaaaccaccgtccttgtgtccttgaaagtactgattcatgcatcatgcataactaaagcaataatacaaagaaaacaaaccc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41796994 |
ggtatctttcatctagaagaaaccaccgtccttgtgtccttgaaagtactgattcatgcatcatgcataactaaagcaataatacaaagaaaacaaaccc |
41797093 |
T |
|
| Q |
201 |
gagaggaatgaagaataat |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
41797094 |
gagaggaatgaagaataat |
41797112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University