View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6635_low_5 (Length: 528)
Name: NF6635_low_5
Description: NF6635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6635_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 61; Significance: 6e-26; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 305 - 385
Target Start/End: Original strand, 39844416 - 39844496
Alignment:
| Q |
305 |
attcatgagtaaatagtgccactgaatgaaattggttggaagattttccattttactcgaaataagggtattgtatacagc |
385 |
Q |
| |
|
|||| ||||||||||||||| | ||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
39844416 |
attcgtgagtaaatagtgccgccgaatgaaattggttggaagattttccattttactcaaaataagggcattgtatacagc |
39844496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 386 - 509
Target Start/End: Original strand, 39844546 - 39844684
Alignment:
| Q |
386 |
tgttaaatactttgattagcaagagtatcaaagtttaaatcacgcaag---------------caacagtggcctggcagctccaatatatgaaggaata |
470 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| ||||||||| ||||| || |
|
|
| T |
39844546 |
tgttaaatactttgattagcaagagtatcaaagtttaaatcaagcaacaaacagtgaagaaaacaacagtggcctggcagcaccaatatatcaaggagta |
39844645 |
T |
|
| Q |
471 |
agtggcaatgatatacgggtaatttgttattcagcattc |
509 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
39844646 |
agtggcaatgatatacctgtaatatgttattcagcattc |
39844684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 258 - 302
Target Start/End: Complemental strand, 29428991 - 29428947
Alignment:
| Q |
258 |
gcagacattcctgtatgatttcctgaaaccagcaaatatcttatt |
302 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||| ||||||| |
|
|
| T |
29428991 |
gcagacattcctggatgatttccagaaaccagcaaatctcttatt |
29428947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University