View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6635_low_9 (Length: 453)
Name: NF6635_low_9
Description: NF6635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6635_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 3e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 251 - 443
Target Start/End: Original strand, 36354785 - 36354985
Alignment:
| Q |
251 |
ttttatgtataatttaactatgttttgctctgctttnnnnnnnntgtgagacaagaggaattaatatacatgtattgt--tgttttaatagaatttaggt |
348 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
36354785 |
ttttatatataatttaactatgttttgctctgctttaaaaaaa-tgtgagacaagaggaattaatatacatgtattatattgttttaatagaatttaggt |
36354883 |
T |
 |
| Q |
349 |
gagtaaatctcaagacttgcaaatgtacttataaattat-------tatattaacaaaatattacatacggttcacatgatagccttcaacgacaaccta |
441 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36354884 |
gagtaaatctcaagaattgcaaatgtacttataaattataaattactatattaacaaaatattacatacggttcacatgatagccttcaacggcaaccta |
36354983 |
T |
 |
| Q |
442 |
tg |
443 |
Q |
| |
|
|| |
|
|
| T |
36354984 |
tg |
36354985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University