View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6636_high_16 (Length: 427)
Name: NF6636_high_16
Description: NF6636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6636_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 379; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 379; E-Value: 0
Query Start/End: Original strand, 15 - 409
Target Start/End: Complemental strand, 3292640 - 3292246
Alignment:
| Q |
15 |
tcatcagccgagttgtatgatcctgatcttgacacgtggagccgtttgcctaatttgcatattttaaggtacaaatgcataggtgtgacatggaaaggta |
114 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3292640 |
tcatcagccgagttgtatgatcctgattttgacacgtggagccgtttgcctaatttgcatattttaaggtacaaatgcataggtgtgacatggaaaggta |
3292541 |
T |
 |
| Q |
115 |
aagtttacatcataggaggattcgctgaaagagaaaactctgatatgacaatgcctagtatagttgaacggagctcagctgaagttcttgactcgcaagc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3292540 |
aagtttacatcataggaggattcgctgaaagagaaaactctgatatgacaatgcctagtatagttgaacggagctcagctgaggttcttgactcgcaagc |
3292441 |
T |
 |
| Q |
215 |
aagaaaatgggacctcattgtaggtatgtggcagctcgacgtgccacctaatcaaattgtggcggtgaatgacactctttttagctcaggggattgtttg |
314 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3292440 |
aagaaaatgggacctcattgcaggaatgtggcagctcgacgtgccacctaatcaaattgtggcggtgaatgacactctttttagctcaggggattgtttg |
3292341 |
T |
 |
| Q |
315 |
aatgcttggaaaggacatgttgaggcgtatgatggtaaattttggaatgaagttgatggatcgcgcaagagaagtctttcaacgttggaatataa |
409 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3292340 |
aatgcttggaaaggacatgttgaggcgtatgatggtaaattttggaatgaagttgatggatcgcgcaagagaagtctttcaacgttggaatataa |
3292246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University