View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6636_high_22 (Length: 394)

Name: NF6636_high_22
Description: NF6636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6636_high_22
NF6636_high_22
[»] chr7 (1 HSPs)
chr7 (20-226)||(45761831-45762039)


Alignment Details
Target: chr7 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 20 - 226
Target Start/End: Complemental strand, 45762039 - 45761831
Alignment:
20 atcactccatcagcaacaaactcaccgtcccaactctctattcattggcatcggttatgtttaataagtccacttattattaatatttgtgaaataaact 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||    
45762039 atcactccatcagcaacaaactcaccgtcccaactctctattcattgccatcggttatgtttaataagtccacttattattaatatttgtgaaacaaact 45761940  T
120 tctgaactttagggtgtgtcaa--ctcttctcgtcaccacaaaaacttttcaagggctgaacatgcagaacttcaaatcctnnnnnnnntctcttgattt 217  Q
    ||||||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||        |||||||||||    
45761939 tctgaactttagggtgtgtcaactctcttctcgtcaccacaaaaacttttcaagggttgaacatgcagaacttcaaatcctaaagaaaatctcttgattt 45761840  T
218 taacaccaa 226  Q
    |||||||||    
45761839 taacaccaa 45761831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University