View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6636_high_22 (Length: 394)
Name: NF6636_high_22
Description: NF6636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6636_high_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 20 - 226
Target Start/End: Complemental strand, 45762039 - 45761831
Alignment:
| Q |
20 |
atcactccatcagcaacaaactcaccgtcccaactctctattcattggcatcggttatgtttaataagtccacttattattaatatttgtgaaataaact |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45762039 |
atcactccatcagcaacaaactcaccgtcccaactctctattcattgccatcggttatgtttaataagtccacttattattaatatttgtgaaacaaact |
45761940 |
T |
|
| Q |
120 |
tctgaactttagggtgtgtcaa--ctcttctcgtcaccacaaaaacttttcaagggctgaacatgcagaacttcaaatcctnnnnnnnntctcttgattt |
217 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45761939 |
tctgaactttagggtgtgtcaactctcttctcgtcaccacaaaaacttttcaagggttgaacatgcagaacttcaaatcctaaagaaaatctcttgattt |
45761840 |
T |
|
| Q |
218 |
taacaccaa |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
45761839 |
taacaccaa |
45761831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University