View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6636_high_28 (Length: 323)
Name: NF6636_high_28
Description: NF6636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6636_high_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 6 - 307
Target Start/End: Original strand, 36979242 - 36979544
Alignment:
| Q |
6 |
agtagcaaaggaggacagtaaatannnnnnncctttcaattttgaattatcaagaataaaagaaaaagagtgtaaaaaggtttgaaaggtgtaacaatca |
105 |
Q |
| |
|
|||| ||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36979242 |
agtatcaatggaggacagtaaatatttttttcctttcaattttgaattatcaagaataaaagaaaaagagtgtaaaaaggtttgaaaggtgtaacaatca |
36979341 |
T |
 |
| Q |
106 |
ttgcaattccaactcaaccgatctcactcactagggtttctttttatcattatttacgaaacaccaacaaaaagaacatgcaatctctatgggatctcac |
205 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36979342 |
ttgcacttccaactcaaccgatctcactcactagggtttctttttatcattatttacgaaacaccaacaaaaagaacatgcaatctctatgggatctcac |
36979441 |
T |
 |
| Q |
206 |
cataccattttgagtttac-nnnnnnnnnacaaaagaaaaaagaaatcttcaacatcatctctatccccacccccaatataccaaaagacaaggaaagag |
304 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36979442 |
cataccattttgagtttacttttttttttacaaaggaaaaaagaaatcttcaacatcatctctatccccacccccaatataccaaaagacaaggaaagag |
36979541 |
T |
 |
| Q |
305 |
aat |
307 |
Q |
| |
|
||| |
|
|
| T |
36979542 |
aat |
36979544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University