View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6636_high_37 (Length: 241)
Name: NF6636_high_37
Description: NF6636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6636_high_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 18 - 178
Target Start/End: Complemental strand, 8186339 - 8186180
Alignment:
| Q |
18 |
ttagagagattgagtgatgtgaggttcaacgaaaaacgagagagttggcagaggacagtgttgaggcaaccattgtacaaagtgaagtcgagggaggtga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8186339 |
ttagagagattgagtgatgtgaggttcaacgaaaaacgagagagatggcagaggacagtgttgaggcaaccattgtacaaagtgaagtcgagggaggtga |
8186240 |
T |
|
| Q |
118 |
gattagtaaacctttgaaaatcgcgacaaaagaaagagagtgagacattttttcgagatag |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
8186239 |
gattagtaaacctttgaaaatcgcgacaaaagaaagagagtgaggca-tttttcgagatag |
8186180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 67
Target Start/End: Original strand, 32152047 - 32152093
Alignment:
| Q |
21 |
gagagattgagtgatgtgaggttcaacgaaaaacgagagagttggca |
67 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||| |||||| |
|
|
| T |
32152047 |
gagagattgagtgatgtgaggttcaacgggaaatgagagatttggca |
32152093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University