View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6636_high_38 (Length: 240)
Name: NF6636_high_38
Description: NF6636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6636_high_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 16 - 238
Target Start/End: Complemental strand, 30708432 - 30708207
Alignment:
| Q |
16 |
cagctgcttcccacatcattggaaaaactatttctgttgatggaaaattcaatgtaaatggatttcagcccagcataaggattaactcaaataaaaacat |
115 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| || |
|
|
| T |
30708432 |
cagctgcttcccacatcattggacaaactatttctgttgatggaaaattcaatgtaaatggatttcatcccagcataaggattaactaaaataaaaatat |
30708333 |
T |
 |
| Q |
116 |
catttttattgtcttcgtttacacagcataaaggtattcaccaaa---tcctgtttatagggtttggctttcagttcattatttctcattttattttctg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30708332 |
catttttattgtcttcgtttacacagcacaaaggtattcaccaaatcctcctgtttatagggtttggctttcagttcattatttctcattttattttctg |
30708233 |
T |
 |
| Q |
213 |
gatggttttcctgatgatgtccatct |
238 |
Q |
| |
|
||||||||||||||| |||| ||||| |
|
|
| T |
30708232 |
gatggttttcctgattatgttcatct |
30708207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University