View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6636_high_44 (Length: 223)
Name: NF6636_high_44
Description: NF6636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6636_high_44 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 121 - 214
Target Start/End: Original strand, 7232985 - 7233078
Alignment:
| Q |
121 |
ggttatcttagttagtttcattctgtgatgtgtcaagttataagctgttacaattgagttacataattgtggtcacatattaccaatttatgaa |
214 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7232985 |
ggttatcttagttagttgcattttgtgatgtgtcaagttataagctgttacaattgagttacataattgtggtcacatattatcaatttatgaa |
7233078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 18 - 57
Target Start/End: Original strand, 7232881 - 7232920
Alignment:
| Q |
18 |
ctcctaaggttaaaattcttatctacactctgatcattag |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7232881 |
ctcctaaggttaaaattcttatctacactctgatcattag |
7232920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University