View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6636_low_30 (Length: 362)
Name: NF6636_low_30
Description: NF6636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6636_low_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 19 - 347
Target Start/End: Complemental strand, 35410178 - 35409851
Alignment:
| Q |
19 |
acttgttctttcatttgttctttcactaagtgaagaagataagatctaactatttattctttcnnnnnnnncagaggtttggcggttccagatgccactc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35410178 |
acttgttctttcatttgttctttcactaagtgaagaagataagatctaactatttattctttcttttttt-cagaggtttggcggttccagatgccactc |
35410080 |
T |
|
| Q |
119 |
agccacatggcattagactacttattgaagattatccttatgcggctgatggactcctcatatggactagtatagagaagttggtcaggacctatgtgaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35410079 |
ggccacatggcattagactacttattgaagattatccttatgcggctgatggactcctcatatggtctagtatagagaagttggtcaggacctatgtgaa |
35409980 |
T |
|
| Q |
219 |
ccattactacaaagatttgaatgccgtttcttctgacaatgaactccagtcctggtacaaagaattcatcaacatggggcaccctgatcataaaaatgct |
318 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35409979 |
ccattactacaaagatttgaatgccatttcttctgacaatgaactccagtcctggtacaaagaattcatcaacatggggcaccctgatcataaaaatgct |
35409880 |
T |
|
| Q |
319 |
acctggtggcctaaactaaacacccctga |
347 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35409879 |
acctggtggcctaaactaaacacccctga |
35409851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University