View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6636_low_35 (Length: 313)
Name: NF6636_low_35
Description: NF6636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6636_low_35 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 20 - 301
Target Start/End: Original strand, 42424035 - 42424314
Alignment:
| Q |
20 |
aaaggaatagttggacttttaagggcgacgaagttgaatctgatgaatgaaaaagaatcgtgggctttaatgtttaccttagaaattaaacctaatatta |
119 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42424035 |
aaaggaatagttggacttttaaaggcgacgaagtcgaacctgatgaatgaaaaagaatcgtgagctttaatgtttaccttagaaattaaacctaatatta |
42424134 |
T |
|
| Q |
120 |
ttgaatttaaacttaggttttgttttttctggtgtgaattgtggttgtgat-ttttgaattgatcatatgaaagtgtttctatcttctattttattttcc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42424135 |
ttgaatttaaacttaggttttgttttttctggtgtgaattgtggttgtgatgttttgaattgatc--atgaaagtgtttctatcttctattttattttcc |
42424232 |
T |
|
| Q |
219 |
attgttcaacttaatcgnnnnnnnnnatgtcaacttgatcattattcgattttatgcgtaaataatttaaatcagtacatatt |
301 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42424233 |
attgttcaacttaatcg-ttttttttatgtcaacttgatcattattcgattttatgcgtaaataatttaaatcagtacatatt |
42424314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University