View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6636_low_42 (Length: 241)

Name: NF6636_low_42
Description: NF6636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6636_low_42
NF6636_low_42
[»] chr4 (1 HSPs)
chr4 (18-178)||(8186180-8186339)
[»] chr8 (1 HSPs)
chr8 (21-67)||(32152047-32152093)


Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 18 - 178
Target Start/End: Complemental strand, 8186339 - 8186180
Alignment:
18 ttagagagattgagtgatgtgaggttcaacgaaaaacgagagagttggcagaggacagtgttgaggcaaccattgtacaaagtgaagtcgagggaggtga 117  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8186339 ttagagagattgagtgatgtgaggttcaacgaaaaacgagagagatggcagaggacagtgttgaggcaaccattgtacaaagtgaagtcgagggaggtga 8186240  T
118 gattagtaaacctttgaaaatcgcgacaaaagaaagagagtgagacattttttcgagatag 178  Q
    |||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||    
8186239 gattagtaaacctttgaaaatcgcgacaaaagaaagagagtgaggca-tttttcgagatag 8186180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 67
Target Start/End: Original strand, 32152047 - 32152093
Alignment:
21 gagagattgagtgatgtgaggttcaacgaaaaacgagagagttggca 67  Q
    ||||||||||||||||||||||||||||  ||| |||||| ||||||    
32152047 gagagattgagtgatgtgaggttcaacgggaaatgagagatttggca 32152093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University