View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6636_low_44 (Length: 239)

Name: NF6636_low_44
Description: NF6636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6636_low_44
NF6636_low_44
[»] chr7 (2 HSPs)
chr7 (7-149)||(7988605-7988741)
chr7 (172-201)||(7988765-7988794)


Alignment Details
Target: chr7 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 7 - 149
Target Start/End: Original strand, 7988605 - 7988741
Alignment:
7 agatttgttggattagtgcttgaaaatccttcaaacttttacaatgagtgacaacgctcttagttaattagtagaaactcgtgatattcatattaattgt 106  Q
    |||| ||||||||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||||| |||||      |||||| ||||    
7988605 agatatgttggattagtgcttgaaaatcattcaaactcttacaatgagtgacaacactcttagttaattagtagaaattcgtg------atattagttgt 7988698  T
107 tctttcgagtaagacgataaccgattcaatgtctgtttagtag 149  Q
    ||||||||||||| ||||||||||||||||||| |||||||||    
7988699 tctttcgagtaaggcgataaccgattcaatgtcggtttagtag 7988741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 172 - 201
Target Start/End: Original strand, 7988765 - 7988794
Alignment:
172 gtacaagtgcttaaaactcatataattgtt 201  Q
    ||||||||||||||||||||||||||||||    
7988765 gtacaagtgcttaaaactcatataattgtt 7988794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University