View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6636_low_44 (Length: 239)
Name: NF6636_low_44
Description: NF6636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6636_low_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 7 - 149
Target Start/End: Original strand, 7988605 - 7988741
Alignment:
| Q |
7 |
agatttgttggattagtgcttgaaaatccttcaaacttttacaatgagtgacaacgctcttagttaattagtagaaactcgtgatattcatattaattgt |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||||| ||||| |||||| |||| |
|
|
| T |
7988605 |
agatatgttggattagtgcttgaaaatcattcaaactcttacaatgagtgacaacactcttagttaattagtagaaattcgtg------atattagttgt |
7988698 |
T |
 |
| Q |
107 |
tctttcgagtaagacgataaccgattcaatgtctgtttagtag |
149 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
7988699 |
tctttcgagtaaggcgataaccgattcaatgtcggtttagtag |
7988741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 172 - 201
Target Start/End: Original strand, 7988765 - 7988794
Alignment:
| Q |
172 |
gtacaagtgcttaaaactcatataattgtt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7988765 |
gtacaagtgcttaaaactcatataattgtt |
7988794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University